LiQuant™ SYBR Green qPCR Master Mix (100 rxns)

LiQuant™ SYBR Green qPCR Master Mix (100 rxns)

Catalog #: M0026-01
Availability: In Stock
$99.00

LiQuant™ SYBR Green qPCR Master Mix is a ready-to-use 2× Taq DNA polymerase-based formulation optimized for real-time quantitative PCR. This SYBR Green master mix contains all reaction components except primers and templates, specifically engineered for intercalation-based detection with SYBR Green I. Compatible with both glass capillary systems and instruments requiring passive reference dyes, the SYBR qPCR mix integrates antibody-mediated HotStart technology to ensure high target specificity and reproducible amplification.
 

Key Features

• Enhanced Specificity: HotStart Taq DNA polymerase and the optimized buffer eliminate non-specific amplification and formation of primer dimers.

• GC-Rich Template Efficiency: A uniquely balanced PCR buffer enables robust amplification of challenging GC-rich targets while maintaining thermal stability at room temperature.

• Transport-Stable Performance: Lyophilization-free formulation ensures uncompromised activity during extended storage and shipping cycles.

• Broad Dynamic Range: Delivers linear quantification across >8 orders of magnitude with intra-assay CV <1.5%.
 

Components

1. 2× LiQuant™ SYBR Green Master Mix: 5×1 ml
2. ROX Reference Dye: 100 µl
 

Storage

Store at 2-8°C and protected from light.
 

Other Size

  Product Name Cat. # Price View
  LiQuant™ SYBR Green qPCR Master Mix (500 rxns) M0026-05 $359


Case Study

sybr green qpcr master mix

Figure 1. Comparison of the specificity between LiQuant™ and Brand N

Template DNA: Eight 10×Dilutes of the pET28a plasmid with Bacillus badius phenylalanine dehydrogenase gene.

Primer: Forward primer AGGAAGCCGATGTGTTCGTT        Reverse primer TTCCGCTTGCTGGTACACTT

From the melting curve, it shows that LiQuant™ exhibits a single peak under both low and high concentration templates, while under low concentration templates, Brand N exhibits non-specific amplification.

 

sybr green master mix

Figure 2. High stability verification

Template DNA: Eight 10×Dilutes of the pET28a plasmid with Bacillus badius phenylalanine dehydrogenase gene.

Primer: Forward primer AGGAAGCCGATGTGTTCGTT        Reverse primer TTCCGCTTGCTGGTACACTT

From the amplification curve, it shows that the LiQuant™ stored at 37 ℃ and at -20 ℃ have the same curve, and the Cq value is basically similar. From the standard curve, it shows that the PCR efficiency of LiQuant™ at different stored temperatures are both at 95% -100%, and the R2 value is 0.999.
 

Publications

1. YAP/TEAD1 Complex Is a Default Repressor of Cardiac Toll-Like Receptor Genes. 
Publication: International Journal of Molecular Sciences

2. Knockdown of lncRNA TP53TG1 Enhances the Efficacy of Sorafenib in Human Hepatocellular Carcinoma Cells. 
Publication: non-coding RNA

3. Selectively expressing SARS-CoV-2 Spike protein S1 subunit in cardiomyocytes induces cardiac hypertrophy in mice. 
Publication: bioRxiv